Épidémie nosocomiale d’origine alimentaire de SHV et de Klebsiella pneumoniae productrice de CTX-M: épidémiologie et contrôle

Contexte Nous décrivons une éclosion nosocomiale d’origine alimentaire due à des β-lactamases à spectre élargi Klebsiella pneumoniaeMethodsUne épidémie de BLK K pneumoniae a été détectée en mars Les mesures de contrôle initial comprenaient l’isolement des contacts et un protocole de détection systématique et de renforcement des pratiques d’hygiène des mains. dépistage des gènes blaTEM, blaSHV et blaCTX-M L’analyse par électrophorèse sur gel en champ pulsé a été réalisée en utilisant XbaI comme endonucléase de restriction. Résultats: Cent cinquante-six patients colonisés et / ou infectés ont été identifiés, dont% infectés. L’enquête a révélé un très court délai entre l’admission et la colonisation. Aucun des travailleurs de la santé ou des surfaces environnementales dans les salles n’a été trouvé pour être colonisé Cela a incité une enquête épidémiologique d’une possible transmission alimentaire Nous avons constaté que jusqu’à% de l’hôpital Les surfaces criblées ou les aliments ont été colonisés et on a constaté que% des manipulateurs d’aliments étaient des porteurs fécaux. L’analyse phénotypique et génotypique de tous les isolats de vecteurs cliniques, environnementaux et fécaux a montré la dissémination d’une seule souche de SHV- et CTX-M– production de K pneumoniae A cette époque, des réformes structurelles et fonctionnelles ont été effectuées dans la cuisine. Elles ont été suivies d’une réduction progressive des taux de colonisation et d’infection chez les patients hospitalisés jusqu’à l’obtention d’un contrôle complet en décembre. Il s’agit de la première éclosion d’un cas d’hépatite signalée qui prouve que les aliments peuvent être un vecteur de transmission de la bactérie K chez les BLSE.

Klebsiella pneumoniae a été associée à% -% d’infections nosocomiales, en particulier celles impliquant les voies urinaires et respiratoires La résistance de cette espèce aux céphalosporines de troisième génération a été décrite pour la première fois en . -lactamase Les souches de K pneumoniae productrices de BLSE ont progressivement augmenté Les infections hospitalières épidémiques causées par des souches multirésistantes sont particulièrement redoutées Dans une récente étude de surveillance internationale,% des épisodes de bactériémie nosocomiale à K pneumoniae ont été causés par des souches productrices de BLSE les unités de soins intensifs, où la consommation d’antibiotiques est la plus forte et le risque de transmission d’organismes le plus élevé,% d’épisodes bactériémiques dus à K pneumoniae ont été causés par des souches productrices de BLSE . comme au Brésil, où jusqu’à>% des isolats de K pneumoniae dans les infections de la circulation sanguine étaient probl ducers À ce jour, & gt; On a signalé des éclosions hospitalières attribuables au K pneumoniae produisant des BLSE, le BLSE-KP . Classiquement, le tractus gastro-intestinal inférieur des patients colonisés a été considéré comme le principal réservoir de ces microorganismes et la contamination croisée a été documentée Cependant, de plus en plus de données suggèrent que la nourriture peut contribuer à la dissémination d’entéro-bactériennes productrices de BLSE dans la communauté Des éclosions nosocomiales d’ESBL-KP d’origine alimentaire n’ont pas été signalées. La présente étude décrit l’épidémiologie. et mesures prises pour le contrôle d’une éclosion nosocomiale d’origine alimentaire d’ESBL-KP dans un hôpital de soins de courte durée

MATÉRIAUX ET MÉTHODES

Réglage

L’Hôpital Universitaire Mútua Terrassa est un établissement de soins de courte durée à Barcelone, en Espagne, avec ~ hospitalisation par année, pour une zone de

Définition et étendue de l’éclosion

L’éclosion a débuté en mars et s’est terminée en décembre. Pendant la période d’étude, les admissions ont été enregistrées. L’enquête épidémiologique a débuté en juin avec l’identification de la surveillance de routine des infections chez des patients infectés par une souche multirésistante ESBL-KP. dans un service médical pendant plusieurs jours Les dossiers du Laboratoire de Microbiologie ont été revus, et d’autres cas ont été identifiés depuis mars. Une étude épidémiologique prospective a été entreprise. Un cas a été défini chez tout patient hospitalisé par culture de colonisation et / ou infection par BLSE-KP. Les infections nosocomiales ont été diagnostiquées et classées selon les définitions standard des Centers for Disease Control and Prevention Après l’identification des premiers cas, un protocole de détection systématique de la colonisation a été mis en place. En juin, un prélèvement rectal de tous les patients hospitalisés a été obtenu en raison de la forte prévalence de la colonisation, le protocole a été étendu progressivement aux autres services hospitaliers Neuf des services ont été examinés ≥ fois de juin à novembre Des mesures d’isolement de cohorting ont été appliquées aux patients colonisés ou infectés jusqu’à ce qu’on obtienne une enquête sur la colonisation environnementale du BLSE-KP dans des unités sélectionnées. culture en frottant des gazes humidifiées à plusieurs reprises sur des sites désignés à proximité immédiate de l’environnement du patient, sur l’équipement utilisé dans les soins aux patients et dans les zones générales dans tous les compartiments des salles étudiées. Puis, des gazes ont été frottées sur des sites désignés, et elles ont été remises dans le récipient. Les gants ont été retirés et les mains ont été lavées. Les contenants ont été incubés toute la nuit en ° C et ensuite prélevés sur ChromID ESBL bioMérieux. campagne proactive pour renforcer les pratiques d’hygiène des mains et l’utilisation de gants edOn juillet, un certain nombre d’événements semblaient justifier une modification de la stratégie de surveillance et de contrôle Premièrement, le nombre de patients colonisés était si élevé que les mesures d’isolement étaient impossibles à réaliser et deuxièmement, les investigations menées suggéraient Par conséquent, les pratiques d’isolement des patients colonisés ont été abandonnées. Les cliniciens ont été informés de l’éclosion en cours et ont été invités à accorder une attention particulière au traitement empirique des infections nosocomiales. Aucune restriction d’utilisation des antimicrobiens n’a été appliquée. les caractéristiques cliniques des patients avec ceux des patients du groupe contrôle ont été réalisées pour identifier et quantifier les facteurs de risque indépendants associés à la colonisation et / ou à l’infection par les BLSE-KP. patients ont été appariés: par sexe, un Les caractéristiques démographiques, les comorbidités, l’exposition à différents antibiotiques, la durée de séjour avant la colonisation et / ou l’infection, l’alimentation, le menu et l’allocation ont été analysées. Le consentement verbal a été obtenu de tous les patients ou d’un parent au premier degré. de tous les employés de l’hôpital examinés

Isolats bactériens

Un échantillon représentatif de l’échantillon d’isolats par patient [souches] et de souches de sources environnementales a été soumis pour étude ultérieure

Détermination de la production de BLSE

Tous les isolats de K pneumoniae qui présentaient une production de BLSE et ont été obtenus pendant la période d’étude à partir de n’importe quel échantillon clinique par des procédures de laboratoire conventionnelles ont été inclus sur ChromID ESBL bioMérieux K pneumoniae et les tests de sensibilité ont été effectués en utilisant Vitek le test de synergie double disque CLSI, M-S

Caractérisation des gènes bla par PCR en chaîne par polymérase et séquençage de l’ADN

Les producteurs de BLSE ont été sélectionnés pour les gènes blaTEM, blaSHV et blaCTX-M. Une PCR individuelle a été réalisée dans les premiers cas, tandis qu’une PCR multiplexe a été utilisée pour caractériser le groupe spécifique CTX-M,, et après l’identification du groupe CTX-M, Dans la présente étude, seules les amorces CtxM-F et CtxM-R, utilisées pour identifier les membres du groupe, étaient requises. De plus, la distinction entre CTX-M et CTX-M, membres, a été réalisée en utilisant les amorces Ctx- / F et Ctx- / R pour amplifier la fin du gène séquençage de l’ADN a ensuite été réalisée en utilisant le BigDye Terminator, version, kit de séquençage de cycle et un séquenceur prisme ABI Applied Biosystems Toutes les amorces sont listées dans Table

Amorces de table utilisées dans la caractérisation de la cible PCR de Klebsiella pneumoniae productrice de β-lactamase à spectre étendu Séquence de noms d’amorces Température, ° C Fragment size, bp Référence ou source Single PCR blaTEM Tem-F GACAGTTACCAATGCTTAATCTem-R ATAAAATTCTTGAAGACGAAA blaSHV SHV_F CGCCGGGTTATTCTTATTTGTCGCSHV_R TCTTTCCGATGCCGCCGCCAGTCA blaCTX- M CTXM-F ATGGTTAAAAAATCACTGCtxM-R TTACAAACCGTYGGTGAC Dr M Cano communication personnelle blaCTX-M_ / Ctx- / F ATAAAACCGGCAGCGGTGCtx- / R GAATTTTGACGATCGGGG Multiplex PCR Groupe blaCTX-M-F CTXM AAAAATCACTGCGCCAGTTCCtxm-R AGCTTATTCATCGCCACGTT groupe blaCTX-M-F CTXM CGACGCTACCCCTGCTATTCtxm-R CCAGCGTCAGATTTTTCAGG Groupe blaCTX-M Ctxm-F CAAAGAGAGTGCAACGGATGCtxm-R ATTGGAAAGCGTTCATCACC Groupe blaCTX-M Ctxm-F TCGCGTTAAGCGGATGATGCCtxm / -R AACCCACGATGTGGGTAG Groupe blaCTX-M Ctxm-F GCACGATGACATTCGGGCtxm / -R AACCCACGATGTGGGTAG Cible PCR Séquence de noms d’amorces Température, ° C Taille des fragments, pb de référence ou une source unique de PCR blaTEM Tem-F GACAGTTACCAATGCTTAATCTem-R ATAAAATTCTTGAAGACGAAA blaSHV SHV_F CGCCGGGTTATTCTTATTTGTCGCSHV_R TCTTTCCGATGCCGCCGCCAGTCA blaCTX-M-F CTXM ATGGTTAAAAAATCACTGCtxM-R TTACAAACCGTYGGTGAC Dr M Cano Communication personnelle blaCTX-M_ / Ctx- / F ATAAAACCGGCAGCGGTGCtx- / R GAATTTTGACGATCGGGG Multiplex PCR Groupe blaCTX -M CTXM-F-R AAAAATCACTGCGCCAGTTCCtxm AGCTTATTCATCGCCACGTT groupe blaCTX-M-F CTXM CGACGCTACCCCTGCTATTCtxm-R CCAGCGTCAGATTTTTCAGG groupe blaCTX-M-F CTXM CAAAGAGAGTGCAACGGATGCtxm-R ATTGGAAAGCGTTCATCACC groupe blaCTX-M-F CTXM TCGCGTTAAGCGGATGATGCCtxm / -R AACCCACGATGTGGGTAG groupe blaCTX-M-F CTXM GCACGATGACATTCGGGCtxm / -R AACCCACGATGTGGGTAG Abréviation: PCR, amplification en chaîne par polyméraseView Large

Typage moléculaire

Pour déterminer la relation génétique des isolats dans notre étude, l’analyse par électrophorèse en champ pulsé a été réalisée en utilisant XbaI comme endonucléase de restriction et en électrophorisant le génome dans un système CHEF DR III Bio-Rad à volts avec des temps d’impulsion de -s et rampe linéaire à une température de ° C pour h clonalité a été acceptée en conformité avec les critères de Tenover

Analyses statistiques

Pour étudier les facteurs de risque indépendants associés à la colonisation et / ou à l’infection par BLSE-KP, les patients ont été comparés aux patients témoins en termes d’exposition aux différentes variables étudiées. Pour les échantillons indépendants, le test Fisher ou le test exact de Fisher ont été utilisés pour les variables catégoriques; pour les variables continues, le test t de Student et le test U de Mann-Whitney ont été utilisés. Le niveau de signification statistique accepté était P & lt; Odds ratios OR et% d’intervalles de confiance Les IC ont été calculés L’OR a été calculé à l’aide de la régression logistique conditionnelle SPSS, la version a été utilisée pour l’analyse

RÉSULTATS

L’épidémie a duré des mois Au cours de l’épidémie, des échantillons de dépistage ont été obtenus Cent cinquante-six patients colonisés et / ou infectés ont été identifiés Figure L’âge moyen des patients était des années, et% étaient des hommes Trente-cinq patients étaient infectés. , tous chez les patients avec un cathéter urinaire à demeure; infections du site opératoire; cas de bactériémie primaire; pneumonie Douze patients colonisés et infectés étaient dans l’unité de soins intensifs Cinq patients sont morts Aucun décès n’était lié à l’infection

Vue en grandDiffuse de nouveaux patients atteints de colonisation fécale ou d’infection due à la bactérie K pneumoniae productrice de BLSE Voir la grande diapositive de téléchargementNombre de nouveaux patients atteints de colonisation fécale ou d’infection due à la souche K pneumoniae productrice de BLSE De juin à novembre, patients dans les services médicaux et chirurgicaux. Dans les unités de soins intensifs ont été périodiquement examinés Dans la figure, nous résumons le pourcentage de porteurs fécaux sur le nombre total de cas de culture sur une base mensuelle Seul le quartier avec la plus forte proportion de patients colonisés est montré en Juin et Juillet,% et% de patients cultivés ont été colonisés, respectivement

Figure Vue largeDownload slidePrévalence de la colonisation fécale avec une souche de Klebsiella pneumoniae produisant des β-lactamases à spectre étendu chez les patients dans les services de santé Seule la salle comptant la plus grande proportion de patients colonisés est représentée.Figure Vue largeDownload slidePrevalence de la colonisation fécale avec un β- Souche de Klebsiella pneumoniae productrice de lactamase chez les patients dans les services médicaux Seule la pupille ayant la plus forte proportion de patients colonisés est montrée. En raison de la propagation rapide et massive de la flambée, nous avons décidé d’exclure une origine communautaire. Admission à l’hôpital qui a visité le service des urgences en juin Considérant l’incidence élevée observée chez les patients hospitalisés, nous avons pensé que les échantillons fécaux consécutifs négatifs des patients externes étaient suffisants. Nous nous rendons compte que cette taille d’échantillon est trop petite pour exclure absolument cette possibilité. Le service de traiteur pour les patients hospitalisés était assuré par une entreprise externe et comportait des lignes différenciées. Une ligne était réservée aux employés hospitaliers et au personnel administratif, et l’autre était réservée aux patients hospitalisés Pour explorer cette hypothèse, des cultures de selles ont été pratiquées en juillet. De plus, en juillet, des prélèvements rectaux ont été effectués auprès d’employés hospitaliers. Le groupe cultivé comprenait du personnel administratif sans contact avec les patients et des travailleurs de la santé. Ces cohortes ne partageaient pas le service de traiteur avec les patients hospitalisés. Chaîne de cuisine et de transformation des aliments: la forte prévalence de la colonisation fécale dans de nombreuses unités hospitalières jusqu’à% dans certains quartiers, la rapidité de sa propagation tous les services médicaux et chirurgicaux ont été simultanément touchés, la colonisation précoce peu après l’admission des patients ont été colonisés. h après l’admission, tous les résultats des cultures environnementales n = provenant des surfaces hospitalières étaient négatifs, aucune colonisation parmi les patients ambulatoires n’a été détectée, et aucun des employés hospitaliers d’où provenaient les échantillons n’étaient des porteurs fécaux De plus, dans la cuisine,% des travailleurs être des transporteurs fécaux transitoires L’un d’entre eux était directement un manipulateur de nourriture Le reste était le personnel de nettoyage Tous travaillaient pendant le quart du soir, et tous déjeunaient à l’hôpital et partageaient exactement le même menu quotidien des patients hospitalisés. le quart du matin a été colonisé Certains d’entre eux avaient déjà déjeuné à l’hôpital, mais ils ont reçu le même menu que le reste des employés de l’hôpital. Les premiers échantillons environnementaux et alimentaires de la cuisine ont été obtenus pour la culture le 18 juillet. Pourcentage de surfaces cultivées et d’échantillons d’aliments contaminés Parmi les denrées alimentaires testées, seule la purée de fruits trouvé contaminée, lorsque ces résultats ont été connus, les changements structurels et fonctionnels et des mesures de nettoyage dans la cuisine ont été effectués Plus de purées de fruits ont été servis à l’hôpital Depuis lors, aucun autre échantillon alimentaire a été trouvé contaminé Trois% des échantillons de cuisine de l’environnement en Août et% des échantillons sur Octobre étaient Ces résultats encore positifs pourraient expliquer au moins en partie la persistance de l’épidémie au fil du temps de nouvelles mesures de nettoyage particulières ont été appliquées sur AugustThe dernières cultures environnementales cuisine ont été effectuées sur Décembre Tous les échantillons prélevés ont été negativeDuring l’épidémie, Nous avons identifié les seules populations à risque d’infection: patients hospitalisés avec cathéter urinaire à demeure et patients avec cancer solide ou tumeurs malignes hématologiques. De juillet à octobre, nous avons décidé de limiter la surveillance aux cultures urinaires hebdomadaires pour tous les patients hospitalisés avec cathéters urinaires et prélèvements rectaux. pour les patients immunodéprimés et pour pa Patients admis dans l’unité de soins intensifs La figure montre la prévalence de la colonisation urinaire

Figure Vue largeDownload slidePourcentage de colonisation urinaire chez tous les patients porteurs d’un cathéter urinaire à demeureFigure View largeDownload slidePourcentage de colonisation urinaire chez tous les patients ayant un cathéter urinaire à demeureAprès l’intervention dans la cuisine de l’hôpital, le pourcentage de patients colonisés et / ou infectés a diminué progressivement des patients en novembre était positif Une nouvelle surveillance a été effectuée en mai Une colonisation fécale a été dépistée chez les patients hospitalisés dans les quartiers ayant les taux de colonisation les plus élevés Aucun nouveau cas de colonisation ou d’infection nosocomiale n’a été identifiéEn analyse bivariée, aucune différence statistiquement significative Par conséquent, nous avons inclus dans l’analyse multivariée les variables avec les OR les plus élevés en analyse bivariée et considérées comme cliniquement pertinentes: sexe, âge, utilisation de l’antibiotique précédent, durée du séjour et consommation de pâtes, de soupe ou de viande ysis a identifié une exposition antérieure à un agent antimicrobien OU; % CI, – et ayant mangé de la soupe OU; % CI, – comme facteurs de risque de colonisation ou d’infection Le profil de sensibilité aux antimicrobiens du BLSE-KP présentait une résistance aux pénicillines et aux céphalosporines de troisième génération. De plus,% des souches étaient résistantes à l’amoxicilline-clavulanate et% résistantes à la pipéracilline-tazobactam Toutes les souches étaient résistantes à la ciprofloxacine et sensibles aux carbapénèmes et à l’amikacine

Tableau Susceptibilité Antimicrobienne des Isolats de l’Epidémique à Spectre Étendu Production de β-Lactamase Klebsiella pneumoniae Susceptibilité de la Souche AMP AMC CXM FOX CTX CAZ CEF AZT GM à AK SXT CIP IMI PT Plage, μg / mL ≥ à ≥ ≥ ≤ à ≥ ≥ à ≥ ≥ ≥ ≤ ≥ ≥ ≥ ≥ ≥ ≥ ≥ ≥ ≥ ≥ ≤ ≥ ≥ ≥ ≥ ≥ ≤ Résistance,% de sensibilité AMP AMC CXM FOX CTX CAZ AZT GM à AK SXT CIP IMI PT Plage, μg / mL ≥ à ≥ ≥ ≤ à ≥ ≥ à ≥ ≥ R ≥ à ≥ ≤ à ≥ ≤ ≥ ≥ ≥ ≤ ≤ ≥ ≥ CMI, μg / mL ≥ ≥ ≥ ≥ ≥ ≥ ≥ ≥ ≥ ≤ Résistance,% Abréviations: AK, amikacine; AMC, amoxicilline-clavulanique; AMP, ampiciline; AZT, aztréonam; CAZ, ceftazidime; CEF, céfépime; CIP, ciprofloxacine; CTX, céfotaxime; CXm, céfuroxime; GM, gentamicine; IMP, imipénème; CMI,% de concentration inhibitrice minimale; PT, pipéracilline-tazobactam; STX, triméthoprime-sulfaméthoxazole; TO, tobramycinView Large L’analyse phénotypique et génotypique des isolats a montré qu’il existait un clone clone A prédominant; des isolats étudiés; les isolats restants appartiennent chacun à différents clones B-F et clone G, qui comprenait des isolats Figure La souche isolée chez les patients initialement infectés était clone A Toutes les souches provenant de sources environnementales appartenaient également au clone A Caractérisation plus poussée des mécanismes sous-jacents de résistance aux céphalosporines a montré que le clone A portait différentes enzymes: SHV- et CTX-M-

Figure Vue grandDownload slide Électrophorèse sur gel à champ pulsé Typage génomique de Klebsiella pneumoniae L’ADN chromosomique a été digéré avec l’endonucléase XbaI et séparé par électrophorèse sur gel à champ pulsé. Les voies – et – présentaient un clone de modèle identique A; voie et a également montré un modèle identique clone GFigure View largeTélécharger slide Electrophorèse en gel à champ pulsé Typage génomique de Klebsiella pneumoniae L’ADN chromosomique a été digéré avec l’endonucléase XbaI et séparé par électrophorèse sur gel à champ pulsé. Les voies – et – présentaient un clone A identique; voie et a également montré un modèle identique clone G

DISCUSSION

l’identification des porteurs fécaux chez les manipulateurs d’aliments et la contamination persistante des surfaces des tables, des éviers et des machines à laver dans la cuisine. Il existe des preuves que les aliments peuvent être un vecteur de transmission des entérobactéries productrices de BLSE. La prévalence des entérobactéries productrices de BLSE dans les éclosions d’infections d’origine alimentaire pouvant aller jusqu’à% et le pourcentage élevé de porteurs dans chaque foyer,% -% renforcent l’hypothèse selon laquelle les entérobactéries productrices de BLSE pourraient être transmises par l’approvisionnement alimentaire Dans la même veine, plusieurs études ont montré que ces souches peuvent être récupérées chez les animaux et les animaux domestiques Un article récent a évalué les isolats d’Escherichia coli producteurs de BLSE provenant de patients infectés et de viande vendue au détail. que la teneur en gènes BLSE des isolats d’E. coli d’origine alimentaire correspondait bien aux gènes qui étaient loca lly prévalente dans les isolats cliniques On ne sait pas comment la première souche ESBL-KP a été importée dans la cuisine et, par conséquent, dans la chaîne alimentaire et les manipulateurs d’aliments. En fait, les manipulateurs d’aliments et d’aliments ont été reconnus comme La propagation horizontale a été reconnue à plusieurs reprises comme le principal mécanisme d’émergence et de maintien des éclosions de K pneumoniae productrices de BLSE. Traditionnellement, les éclosions de K pneumoniae productrices de BLSE sont liées à la transmission croisée, particulièrement dans les régions où l’utilisation d’antibiotiques est la plus importante. Le potentiel de transmission d’organismes aux patients est le plus élevé, comme les unités de soins intensifs, les unités néonatales et les unités chirurgicales. Plusieurs études récentes confirment cette hypothèse Dans les éclosions de K pneumoniae productrices de BLSE précédemment signalées, les sources environnementales amovibles étaient rarement identifiées. dans quelques cas, une source commune causant la dissémination de la BLSE a été signalée […], la K pneumoniae productrice de BLSE colonise transitoirement les mains des membres du personnel hospitalier, facilitant ainsi la transmission patient à patient. En raison du mode de transmission inhabituel de l’épidémie actuelle, des mesures de contrôle des infections, telles que l’isolement L’épidémie a été stoppée seulement après l’application de mesures de contrôle dans la cuisine, mais la prévention de la transmission horizontale et une dissémination plus large de la souche multirésistante ont été arrêtées. L’absence de nouveaux cas au cours de la période de suivi de mois suggère l’efficacité de ces mesures. Les études sur les éclosions d’espèces de Klebsiella productrices de BLSE ont montré que son émergence est généralement associée à l’utilisation de céphalosporines de troisième génération. l’utilisation de la ceftazidime ou de toutes les céphalosporines est suivie par une diminution de la présence d’organismes producteurs de BLSE Nous avons également identifié une exposition antérieure aux antibiotiques comme facteur de risque de colonisation ou d’infection due à la souche épidémique de BLSE-KP Néanmoins, l’épidémie actuelle diffère de celles précédemment décrites dans un aspect important: aucun antibiotique des restrictions ont été appliquées L’identification et le contrôle de la source étaient suffisants pour obtenir un contrôle rapide de l’éclosion. La souche à l’origine de l’éclosion était un producteur CTX-M Au cours de la dernière décennie, le CTX-M représentait le groupe de BLSE le plus en croissance rapide. Plus précisément, CTX-M- est apparu comme le type dominant de BLSE chez les pathogènes à Gram négatif provoquant des éclosions dans les milieux nosocomial et communautaire La dissémination clonale des E. coli producteurs de CTX-M a été reconnue dans de nombreuses régions a généré un réservoir génétique important à partir duquel d’autres espèces qui partagent le même environnement écologique, comme K pneumoniae, pourraient facilement acquérir cette résistance gen e En fait, il a été récemment rapporté que CTX-M- s’est propagé avec succès dans plusieurs clones de K pneumoniae, tant au niveau communautaire qu’au niveau nosocomial Des flambées d’isolats de K pneumoniae producteurs de CTX-M ont déjà été rapportées dans certains pays européens ; En conclusion, le présent rapport décrit la dissémination rapide et généralisée d’un clone épidémique de K pneumoniae productrice de CTX-M et de SHV provoquant une importante épidémie nosocomiale à travers la chaîne alimentaire. À notre connaissance, il s’agit du premier rapport qui explique comment la transmission des BLSE-KP peut se produire dans les aliments en milieu hospitalier. Les équipes de lutte contre les infections doivent tenir compte du fait que les aliments peuvent être un vecteur de transmission pour les souches multirésistantes. en milieu hospitalier, et ils devraient envisager d’étendre leur surveillance aux installations de cuisine et aux denrées alimentaires Conflits d’intérêts potentiels Tous les auteurs: pas de conflits